Blastocladiella emersonii clone report

Clone ID BeE30N16D05
Best BLASTX Match gb|AAS53660.1|
Function Description AFR289Wp [Ashbya gossypii ATCC 10895]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N16D05
CACCTCGTCATCTCGATTGTTGCTGAAGCGAGGAAGACTTGGCGCAACGT
CATGAAGCGGGCCGCATCAGAGGTCCAGTCAAACTCGATGGATCAGGTCG
CACCCATGGAGCACTCCGTCACTCTTCAGGTCCCGTTCCCAACAGCACAC
CTTGCCTCGATCGCCGCGCGGGTTCTGGCTGTGGACAAGCCGTTGAAACC
GCGCGAGTCGCGATCCAGCTTCCATGAGGTCGACTCGATGCTCGAAGTGA
TCGTCGAGGCAACCTCGGTCAAGATGCTGCGGACGGCCGTCAACTCGCTC
ATGGAGCAGCTGGCCAGCGTCGCGCTGACCATGAGCGAGTTTGCAGAGTA
GGTAGGGGCGTTGCGAAAGCAGGATATGATTTATTTTTTAACCT
    




The gene BeE30N16D05 is related to E30-NOR-16-D05-U.AB1 ():

Sequence ID Image
E30-NOR-16-D05-U.AB1
No Image