Blastocladiella emersonii clone report

Clone ID BeE30N16C01
Best BLASTX Match emb|CAB11066.1|
Function Description SPAC6B12.04c [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N16C01
CACGAACCGGGCCTCCACATCCGCTGGACGCCAACGTATCTCTTTCTCAA
GAACGCCAGGAAACCAGCCATGGCCGCCCGCCTCCCGCGCTGCTCAGACC
GCGTCGCCCACTTTGTCCAGGATGTCTGGTCCGTCTTCTCGCCGCTGGCC
ATCAAGACGGGCGCCGTGAACCTCGGCCAGGGCTTCCCCAACTTCCCGCC
GCCCGCCTTCATCAAGGAGGCCGCCGCCAAGGCCATCGGGCCCGACCTCA
ACAACCAGTACGCGCACCCCAAGGGCCAGCTGGCCCTGCGCAAGGAGCTC
GCCACCACCTTCTCGCCGCTGTTCGGCCGCGCCCTGGACGTCGAGGAGAA
CATGGTGGTGACGGCGGGCGCCAACGAGGCCATCTACGCAACGCTCGCCG
CGTACCTGAACCCGGGCGACGAGTGCATCATGATGGAGCCCTTCTTCGAC
CAGTACGAGCCCAACGTGACGCTCAACGGCGGCGTGCCCGTCTACGTGCC
GCTGCGCCAGCAGCCGGGCTCGGGTGACTGGACGCTCGATATCGCCGAGC
TGCAGGCCAAGATCACCCCGCGGTCCCGCGTCATCATCNGTCACACCCCG
CACAACCCGACGGGGAAGGTGTTCACCCGCGCCGAGCTGCTCGCCATCGG
CGCCGTCGCCGCGGAGC
    




The gene BeE30N16C01 is related to E30-NOR-16-C01-U.AB1 ():

Sequence ID Image
E30-NOR-16-C01-U.AB1
No Image