Blastocladiella emersonii clone report

Clone ID BeE30N16A05
Best BLASTX Match ref|ZP_01143506.1|
Function Description CoA-binding protein [Geobacter uraniumreducens Rf4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N16A05
ATCGATCATCCGACGGCGACATCCCGCAAACATCACACATCACGCACGCG
CACACGCCCGACGCTCCGACACGCTCGCTCTCCACCAACCCACCATGTCA
ACTACCGCCATGCCCCAGTTCCTCTCCGCCGCGCGCTTCGTCGTCGTTGG
CGCCTCGGCCAGCCGCGAAAAGTTCGGCAACCGTGTCCTACGCTGGTACC
AGCAGCACGGCCTCGAGGTCGTCCCCGTCAACCCGCGCGAGAAGGAGATT
GAGGGCGTCGCCGCCGTGCCGTCGCTCGCCGAGGTGCCCGGCAACCCCGC
CGACTACAGCGTCTCGGTCATCACGCCGCCCGCCGCCACCGCCGCCGTCA
TCAAGCTCGGCGTCGAGCGCGGCTTCACCCGCTTCTGGCTGCAGCCCGGT
GCCGAGTTCCCCGGCTGGGAGGCCTTTGCCAAGGACCACGGCGTCGCCAT
CATCGGCGGCGGCGCGTGCATCCTCCGCGACGCCAAGCTGTAAGGCTTCC
TCTCTCGTCCGCCTCCTTCCTCTCTGTACATTTTCTGTATAAATTCTTCC
CAACC
    




The gene BeE30N16A05 is related to E30-NOR-16-A05-U.AB1 ():

Sequence ID Image
E30-NOR-16-A05-U.AB1
No Image