Blastocladiella emersonii clone report

Clone ID BeE30N15H05
Best BLASTX Match ref|XP_568946.1|
Function Description DNA unwinding-related protein [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N15H05
CCCGCGTCCGGCGGCTGTCGCTGCGGCAGAACATTGCCATGTCGGCGCCC
ATCATGTCGCGGTTCGACCTGTTCTTCGTGGTGCTGGACGAGTGCGACAT
GGCGACCGACATGCACCTCGCCGAGCACCTGGTGCGCGTGCACCGGTTCC
GCGAAGAGTACCTCGAGCCCGTGTACCCGCTCGAGCGCGTGCAGCGGTAC
CTGCGGTTCGCGCGCACGTTCCAGCCCAAGATGACCCACGAGGCCGCGCG
CCTGCTGCGCCAGCAGTACAACGAGCTGCGCCAGGAGAACGACCTCAAGG
CGCACCGCGTCACGGTGCGCCAGCTCGAGTCCATGGTCTGCCTGTCCGAG
GCCCTCGCGCGCCTGCTCAAGAAGTCGATCCTGCACATCGAGACGGCCTC
GGCCGATATCGAGCTCAACGACGACGCCGTCATGGCGGGCGCCGGCGGCG
ACGTGCAGCTGGCTCCGGGCGAGGACGACCTCGCGCAGATGGCTGCCGCG
CAGCAGGCCGCGATGGCCGAGGCCGCC
    




The gene BeE30N15H05 is related to E30-NOR-15-H05-U.AB1 ():

Sequence ID Image
E30-NOR-15-H05-U.AB1
No Image