Blastocladiella emersonii clone report

Clone ID BeE30N15G12
Best BLASTX Match ref|ZP_01141831.1|
Function Description chorismate mutase/prephenate dehydratase [Geobacter uraniumreducens Rf4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N15G12
CTCGGAAAGCTGCGCAAGGACATTGACTCGCTGGACGCCAAGATTGTGGC
GCTGCTCAACGAGCGGGCGACCATCTCGGTGCAGGTCGGTCGCGCCAAGG
CCGCGGGCACTCGTGCCACGAGTACCGATGTGGATATGACTGGCGACGGC
TCCGCCGATGCCGAGGCGGCGGACCAGCCGCCCGCGCAAGTGTACGTGCC
GCGGCGCGAGCGCGAGGTGCTCGAGACGGTGGTGCAGCTGAACCACGGCC
CGCTCAGCAACGAGGCCGTGGTGGCCATCTACCGCGAGATCATGTCGGCG
AGCATCTCGCTGCAGCAGCAGGTCGCCGTGGCGTTCCTGGGCCCGGCGGG
GACGCACTCGCACCAGGCGGCCATGGACCGGTTCGGCGACAGCGTGCTGT
ACGTGCCCATGGCGACGATCGCCGAGGTGTTCACGGCGGTCGAGCAGGGC
CGCACGCTGTACGGGCTGGTCCCCTTTGAGAACTCGACGTTCGGCAGCGT
GGCGCAGACGCTCGACCGGTTCATCTCGAGCCCGCTGCAGATCCGCGGCG
AGACGTACCTGCCGATCCACCACTATCTCATGTCCAACTCGCAGCTGCAC
TCGATCCGTCGCGTCTACTCGCACCCGGAGGCGCTCGGACAGTGCCAGCG
GTTCC
    




The gene BeE30N15G12 is related to E30-NOR-15-G12-U.AB1 ():

Sequence ID Image
E30-NOR-15-G12-U.AB1
No Image