Blastocladiella emersonii clone report

Clone ID BeE30N15E08
Best BLASTX Match gb|AAV34147.1|
Function Description EF-1 alpha-like protein [Pavlova lutheri]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N15E08
CGCGCACTAATTCACCATGTCTGAGGGCAAGCCCCATCTTTCGATCGTCA
TCTGCGGCCACGTCGATTCCGGCAAGTCGACCACCACCGGTCGCCTGCTC
TTCGAGCTCGGCGGTATCCCCGAGCGTGAGATGGAGAAGCTCCGCGCTGA
GGCCGATGCTCTCGGCAAGTCGTCGTTCGCCTTCGCCTTCTACATGGATC
GCCAGAAGGAGGAGCGCGCTCGCGGTGTCACCATCGCCTGCACCACCAAG
GAGTTCTTCACCGAGAAGTGGCACTACACCATCATCGACGCCCCCGGCCA
CCGCGACTTCATCAAGAACATGATCTCGGGTGCCGCCCAGGCCGATGTCG
CCCTCCTCATGGTCCCCGCCGACGGTAACTTCACCACGGCTATCCAGAAG
GGTGACCACAAGGCCGGTGAGATCCAGGGCCAGACCCGCCAGCACGCTCG
CCTGCTCAACCTCCTCGGTGTCAAGCAGCTCGTCGTCGGTGTCAACAAGA
TGGACTCGGACCCCGCTGGTCCCTACAAGAAGGAGCGCTACGACGAGATC
TCGGCCGAGATGAAGGACATGCTCATCAAGACCGGCTGGAAGAAGGACTT
CGTCGAGGAGTCGGTCCCCGTCATCCAGCCCCTCGTCGTCGACACCTTCG
GCAACTGCGAGGGTCTGTCGCGCATTGCCTCCTCGACGGCACACCGCCGT
CATGCTGGGCAAGTCGTCGCTGTTGAGCACAGTAAACACTCGTCCTCCCG
CTGGCGTGGTTCCTAGTATCTCGGTAGCGCGGTCGCGCACTAAACGCTCG
CCTCCTCATCTCCCTATGGCTTCTGTCCTCCCTCTGTACAGTGGATCATG
AGTGAAATTGTGG
    




The gene BeE30N15E08 is related to E30-NOR-15-E08-U.AB1 ():

Sequence ID Image
E30-NOR-15-E08-U.AB1
No Image