Blastocladiella emersonii clone report

Clone ID BeE30N15D12
Best BLASTX Match ref|XP_749605.1|
Function Description vacuolar sorting-associated protein [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N15D12
GGAGGCCCGTACGCGTAGTGGCCCGCGGGCGGCGGCGGCGGGGACTGCGT
CGGGCCAGGTGGCGGGTACATGGCCTGCTGCTGGGGCTGCTGCTGGGGCG
GTGGTGGCATCGGCGCGCCGTTCGGGTAGCCCGCGTGCTGCGGCGGACCG
GGCGGGAACCCGTTCGGGCCCTGCATCTGCGGCGGCGGGGTCGGCGCGTG
GTACTGCTGCGGCGGTGGGTGCGGGCCAGGATACCCGTGCTGGTCGCCCG
TGTACATGTGCGGCGGCTGTGGTTGCTGCTGCTGCGGGTACCCAGCCGGA
CCGCCGCCGTGGTACGCGGGCGGACCCAACGCCGCCGCTGGCGGCTGAGA
CGGCGCGTGCGGTCCGCCGGCGAGCCCAGACTCGATAGCCTCGTCGTACA
TGCGGAGGGCGGCGCCGACGCGGCGGTGGAGGTCCTCGAGCTGGCGGTGC
ACGGCGAGCGTGTCGTGCAGCGAGGTGGTGAGCTTCGGGTGGAGGAGCGC
CATGGACTGCTGCAGCGACGCGTACTCGCGCGACCCGAGGATCGCCGAGG
CCTGGCCCTGCTCCTCGATACGCTGCATCATGGACGCGAACAACTCGATG
TTCTCCATCTCGGTCGCCGTGAGCTCGAGGACCTGCTGCTGCTGCTGCTG
TTTGAGCGCAGCCGCAGCCGCAGCAGCTGCTGCCGCAG
    




The gene BeE30N15D12 is related to E30-NOR-15-D12-U.AB1 ():

Sequence ID Image
E30-NOR-15-D12-U.AB1
No Image