Blastocladiella emersonii clone report

Clone ID BeE30N15D10.1
Best BLASTX Match ref|XP_478822.1|
Function Description putative beta-N-acetylglucosaminidase [Oryza sativa (japonica cultivar-group)]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N15D10.1
AGCACATAACTGCGTGGTTTATGATCATGTACACCCACAACCTCCTCCAC
CCGCTACTCGCCGCTGACACACTCGCCCGCGCGTCCGCGGCACCACGTCG
GCTGGAGCGGGGCCGACGGCACGCCGCGCCACGAGAGGAGCCGCTCGCGC
GCGTCGTGCAGGCGCTCCGTGACGTCGACCCAGCGGTTGCCGTCGGTGCC
GGGGTCGACGCCCGGGTGGCTCCACGCGCGCTCGGCGAAGGCGACGGCGC
GAGGGAAGATGCGCTGCATCACGTTGCCCGCGTCGGCCTGCTCGGTCCAC
ATACACACTTCTCCCCCGATCACGGCGTCTTTCGCGACAGGGAGAGCGGG
TGCGGACCACGAGGGGCCGTCCGCGGGAGCCGTGTCGCCGGGGAACGGGT
CGTAGTCGTACACGGCGCCCCAGGGGCGCTTTTTGCACCACCCTAGTGCC
TCGACAGGAGCCCCAGTTGTCCAAGCCCCATGGCCGCAGTCAAGGTACCA
GGCGTTGGCGTTGGACACGATAGCCTGTTTGCCGGCCTTCTTGACGAGCG
CGAGCGTGTCCGGGTCCGACTTGGTCCACAGCTGGACCGCCTGGAACA
    




The gene BeE30N15D10.1 is related to E30-NOR-15-D10-1.AB1 ():

Sequence ID Image
E30-NOR-15-D10-1.AB1
No Image