Blastocladiella emersonii clone report

Clone ID BeE30N15D02
Best BLASTX Match gb|EAS31380.1|
Function Description hypothetical protein CIMG_06859 [Coccidioides immitis RS]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N15D02
CAACCCGCCATGGAGACGCAGAACAACACTATCACGCTCGAGGTCGCCTT
CCAGCGCCGCACCTTCCACCTCGACGCCGTCGACCCCGCCGCCACCACGC
TCGGCAGTGTCAAGGAGATGCTCGCCGAGTGGAGCGGGGTCCCTATTGCC
GGGCAGAAGCTTATGTACAAGGGCAAGCTGCTCGCCAACGACGCCGCCGA
CCTCGCGGCATCCGGCATCACGGCCTCCGCGAAACTCCTCCTGTCGGGCT
CGTCGGCCGCCGACGTGAAGCGGATCCAGGACAAGCGCACCGCTGCGCCG
TACAAACCTGTATCGCTGTACGCCAAGAAACCCGCCTCCGCCGCCCCGGC
ATCGCAGTACACGTTCCACGCGATCGAGGTGCTCCCGCTGCCGCAAGCCG
ACCGCGCGCGCGCCGTCCTCGAGCGGCTGCGCGACGACACGGGCGTGCGC
GCCATCATGGACGCGAACCGGTGGGCCGTCGGGAAGCTGATTGAGCTTTC
GCCGACCGAGCACACGATCCTCGGGTACAACCGCAACAAGGGCCAGGTCA
TCGCGCTGCGCCTGCGCACCGACGACTTTGCCGGGTTCCGCCACTTTGAC
GGCGTCTGCAAGGTGCTCCTGCATGAGCTCGCGCACATGGTCCATTCCGA
CCACGACGAGCAGTTTCATGCGCTT
    




The gene BeE30N15D02 is related to E30-NOR-15-D02-U.AB1 ():

Sequence ID Image
E30-NOR-15-D02-U.AB1
No Image