Blastocladiella emersonii clone report

Clone ID BeE30N15B12
Best BLASTX Match dbj|BAF10657.1|
Function Description Os03g0114300 [Oryza sativa (japonica cultivar-group)]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N15B12
GCAACCATCCACCGTGCCATGAATCACACTCGCCACCATGTCGACGTGGC
GCACCTCACGGCTCGACCGTGATCGCGAGTATCGCAAAATCAACTTCTCG
TCCGACATCAATGACTACCAGGTCCAGGAGCCCATATGCGGCGTCGACGA
TATGTCGTACCTATACCTCGCGATCCACAAGCCGTCCGGCCGCAAGGTCG
CGATGAAGTTCACCGACTTGAAGATCTCGCGCGAGATGGCGCTGCTTGAC
GAGCTCACGACAGTAGCAGTCAACACGATGCGGTATCAGCACGAGTCGCT
GCTGCCCTACTTCAACACGTTTGTCAGCGACGAGAACCTGTGGAGCGTCA
CTCTCCCCATGAAAGCTGGAAGCTGCCGAAACATTCTCGACGAGTGCTTC
CCTAACGGCTTCTCCGAGACAGACGTCGCGACCATGCTCAAGTACATTCT
CCGCGGCCTCGACTACCTCCACGATCAAGGTGTCATCCACAACGACATTC
GAGCACAAAACGTGCTCGTAGCCTTTGAC
    




The gene BeE30N15B12 is related to E30-NOR-15-B12-U.AB1 ():

Sequence ID Image
E30-NOR-15-B12-U.AB1
No Image