Blastocladiella emersonii clone report

Clone ID BeE30N15B06
Best BLASTX Match gb|AAL04507.1|
Function Description glutaredoxin [Tilia platyphyllos]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N15B06
CGCACTCACTGCAACGTATCAAGGTCCGCCGCCGCCGCACCCTCCACGTA
TCGCCGCCACGGACGCCATGGGCCAACTGTTCAGCTCCGCGCCCGCAGAC
CCCGAAATGGCCTCCAAGGTCGCCGCCACCGTCGCCAAGCTCATCTCGGA
CAACGCCGTCATGGTGTTCTCCAAGTCGTACTGCCCGTACTGCACCAAGG
CCAAGGACGCGCTCAAGGCCGTCGGCGCCGCGTTCCACGCCATCGAGCTC
GACCAGATGAACGAGGGCGCCGAGATCCAGGCCCACCTCGCCGAGCTGAC
CGGTCAGCGCACCGTGCCCAACATCTTCATCAAGGGCAAGCACATTGGCG
GCTGCTCGGACCTCCTCGAGCTCAAGTCGTCGGGCAAGCTGCAGTCCATG
CTCTAAGCAGCACCACCAGCCGCGCCTCTTGCTTTGCATCGAGTGTAATA
TACGAGTGATCTACGCC
    




The gene BeE30N15B06 is related to E30-NOR-15-B06-U.AB1 ():

Sequence ID Image
E30-NOR-15-B06-U.AB1
No Image