Blastocladiella emersonii clone report

Clone ID BeE30N15B02
Best BLASTX Match ref|XP_792150.1|
Function Description PREDICTED: similar to cystathionine-beta-synthase [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N15B02
CAAACGTATTCGTTTCCTATTCAGCAGTAGTAGTTTCTCGTTTCGTTGCG
TCTACGTCATCCCGTCGCCCGTCTTACTTGATGTAGTGCATGCAGTCCTC
GGGGACCGCCGTTAGGAGGCCCTTGCTCTCGAGCCACGCGCGGTTGAAGA
GTCGGCTCGCGTACCGCTGGGCGCCGTCGCACAGGATCGTAGCGACCGTG
TGCCCGGGCCCGAGCCGGGTGGCGACCTGGA
    




The gene BeE30N15B02 is related to E30-NOR-15-B02-U.AB1 ():

Sequence ID Image
E30-NOR-15-B02-U.AB1
No Image