Blastocladiella emersonii clone report

Clone ID BeE30N14G07
Best BLASTX Match gb|AAI09400.1|
Function Description Putative pyruvate dehydrogenase phosphatase isoenzyme 2 [Danio rerio]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N14G07
TTGCGGTCCGGTCCGGAATTCCGGGTCGACCCCGCGTCCGGGACCGCCGT
CGAGCTGACGCGCGACCACGACGCCGAGAACCCGGGCGAGCTGGCCCGCA
TGCGCGCCGAGCACCCGGGCGAGGAGTCGACGGTCGTGGCGCGCGGCCGA
GTCCTCGGCGGGCTGCAGCCGTTCCGCTCGATGGGCGACGCGCGGTACAA
GTGGCCGCACGCGACGCAGGACTGGATCGGCCGCGTGTTCGCGTCGTCGC
AGTACCCGTACAAGCGCATGCCGCGCAACTACCTGACGCCGCCCTACGTG
ACGGCGCACCCGGAGGTGGCCGAGTACGCGCTCGACGACGCCGACCACTT
CATGGTCCTCGCGACCGACGGCCTGTGGGAGCGCATGACCAACGACCAGG
TCGTCGATATGGTCGCCGAGTACGTCGCCCGCAAGGAAAAGGGCCAGTGG
GCGCACGAGGACGCGAATGCCGCGGCGCACGTCGTCCGCAACGCGTTCGG
CGCGCGCGACACGGAACTCGTCGCGTCGCTCCTCAAGATCCCCGCGCCCC
TCTCGCGCCGGTACCGCGACGATATCACCGTGACCGTCGTCTTCTTCAAG
CCCGCCAACCGCGACACGCTCGGCCCGCAGTTTGCCCCCGAGACCAAGGT
CGCCCCCGAGCCCGCCGACGTTGCGCGCAGCAAGCTCGTCGTCACCAGGA
CGGGCTCGATGTCCGGTCCGGCCTGCCCGCTGCCNANTTGTANGNTGGNA
GNAGNAGNNAGAGAGAATCTANTATATTTTTGTGGTTTTGGG
    




The gene BeE30N14G07 is related to E30-NOR-14-G07-U.AB1 ():

Sequence ID Image
E30-NOR-14-G07-U.AB1
No Image