Blastocladiella emersonii clone report

Clone ID BeE30N14E08
Best BLASTX Match ref|ZP_00667154.1|
Function Description Methionyl-tRNA formyltransferase [Syntrophobacter fumaroxidans MPOB]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N14E08
GAACTCGATCGCGACTCGGCGCAGATTACTCAACGCGGCCACCGCCACCC
GCTTCCCGCGGCTCCGCGCGTACCACGTCGCCTTCTTCGGCTCGGACGAC
TTTTCCGCGCGCGTGCTCGGCAACCTGCTCGACGCCGCCCCGCCCGGCTC
CGCGCCGCTCGACTCGGTGACTGTCGTGACGCCGCCGCCCCGCGCGCGCG
GCCGTGGGCTCGCCGTGACGCCCGGCGCGCTCGAGTCCTTCGCCGACGCG
CGCGGCCTGCCCGTCGTGTACGCGCCGAGCAAGTCGCTCAAGCCGTGGAT
CGCGAATCCGCCCGCCGGTTTGAACTGTGACCTCGCGGTCGTCGTTTCGT
TCCCGTACTTTTTGCCCCGTGCCGTCCTCGAGCGGTTCAGCACGGGCGCC
GTCAACTTGCACCCGTCGTTGCTGCCAAAGTACCGCGGCGCGGCACCCAT
CCAGCACGCGATTTTGAATGGGGATACCGAGACGGGTGTGAGTATCATTG
GGCTCGACCCGCGCCGGTTCGATTCGGGCGCGGTGCTGGCGCAGCGGAAA
GTGGCGATCCCGAACCCCGACAAAATCACGTACTCGACGCTCGCGCCGCG
CCTCGCCGACGAGGGAAGCATCGCGCTCCTCGACACCCTGCGCAACTTTG
ACGCCTTCTCGCGCGCCGCGAAAACCCAGACGAGT
    




The gene BeE30N14E08 is related to E30-NOR-14-E08-U.AB1 ():

Sequence ID Image
E30-NOR-14-E08-U.AB1
No Image