Blastocladiella emersonii clone report

Clone ID BeE30N14D03
Best BLASTX Match gb|AAH93807.1|
Function Description Histone 1, H2ad [Homo sapiens]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N14D03
CCCGCGTCCGCTCGTTGGATTATCATCATCTTCGACCACGTCGAGCCGCA
CTCCACCGTGAGCGCATCTTCAAGTTCATCCTCCACACGCACCACCACAC
TCTACAAACATGGCTGGCAAGGGCGGCAAGGGCGGTAAGGCTGACGCGGC
GTCGTCCGAGAAGAAGTCGAGCTCGCGCTCGTCCAAGGCCGGTCTGCAGT
TCCCCGTCGGCCGCCTGCACCGCATGCTGCGCAAGGGCAACTACTCTGCG
CGCACGGGTGCCGGCGCGCCCGTGTACCTGGCCGCGGTCCTCGAGTACCT
GACGGCCGAGATTCTCGAGCTCGCGGGCAACGCCGCGCGCGACCAGAAGA
AGGCCCGCATCATCCCCCGCCACCTGCAGCTTGCGATCCGCAACGACGAG
GAGCTGTCCAAGCTGCTGCACTCGGTTACGATCGCGCAGGGTGGTGTTCT
GCCCAACATTCAGCCCACCCTCCTGACCGGCTCGGGCGCGCCCGCCGCCA
CCAAGAAAAAGGCCGCCGCCAAGGACGAGAGCGACTCGCAGGAGTTCTAG
GTCGTTTGCCTACTTCTGTCCCTTGCGTGCTACCTATCCCTACCCTATCT
CGATCTCTCTGAGTGTACATACACATCCCCTTTTGTTGATC
    




The gene BeE30N14D03 is related to E30-NOR-14-D03-U.AB1 ():

Sequence ID Image
E30-NOR-14-D03-U.AB1
No Image