Blastocladiella emersonii clone report

Clone ID BeE30N14B08
Best BLASTX Match gb|AAH10780.1|
Function Description Processing of precursor 7, ribonuclease P family, (S. cerevisiae) [Mus musculus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N14B08
GCGGCCAGAGCACGCCAACGAGAAGCACAAACGCGTCAAGAAGAACCCGG
TGCGCGCGTCGCCGTCGCCGATTGACATTTACGTGACGACGGACAAGACG
ACGCCGGTCCGCGCGTACCTCGCCCGCGCGCGCAAGATGCTCGACACGCA
AGGAGAAAACTTTGTGGTGATCCACGGCCTCGGCAAGGCGATTGAGCGGG
CGGCGCTCGTCGCGACGATGCTGCAGGAGCAGTACCTGGGCGCGGCCACG
CTCGAGGTGACGACGGACACGGTGCGGCTGGCGGACGAGCTCGACTACGA
GAACGAGGACCTGGAGCCCGAGATGGACGTGCGGCAGTCGTCGGCGATCC
ATGTGCGGGTAGCCAAGAAGGCGATCCTCAGCTCGGCGCTGCAGGGCGTG
TCGGCAGCGGCGTCGCAGGCCGAGCGTGGGGCGGAGCAGCAGGTGAGTAC
GAAACCATGAGCCGAAATACAGTGATGCTCCTCGG
    




The gene BeE30N14B08 is related to E30-NOR-14-B08-U.AB1 ():

Sequence ID Image
E30-NOR-14-B08-U.AB1
No Image