Blastocladiella emersonii clone report

Clone ID BeE30N13H12
Best BLASTX Match ref|XP_968212.1|
Function Description PREDICTED: similar to CG12141-PA, isoform A [Tribolium castaneum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N13H12
CATGCGCATCGCGCCCGAGCTGTTCCTCAAGATGCTCGTGGTCGGTGGGC
TCGACCGCGTCTACGAGATCGGCCGCCAGTTCCGCAACGAGTCGATTGAC
CTGACCCACAACCCCGAGTTCACGACCTGCGAGTTCTACATGGCGTACGC
CGACGTGACGGACCTCGAGCAGCTCACCGAGCAGCTCGTCTCGGGCATGG
TCAAGTACGTGACGGGCGGGTACAAGCTCAAGTACAACCCGGAGCCCGAC
TCGGACAAGACCTACGACATCGACTTCACGCCCCCCTTCCGCCGCATCCG
CATGATCCCGGGCCTCGAGGAGCGCCTCAACGTGACGTTCCCGCCCGCCG
ACGAGCTGGCCGGCGAGAAGGGCCGCAACTTCCTCGACAACCTGTGCAAG
AAGCACAACGTCGAGTGCGGCGCGCCGCGCACGTCCGCTCGCCTCCTCGA
CAAGCTGGTCGGCGAGTTCCTCGAGTCCGAGTGCATCTCGCCCACGTTCA
TCACCGAGCACCCGCAGTTCATGTCGCCGCTGGCCAAGAAGCACCGGTCC
GTGACGGGTCTGTGCGAGCGGTTCGAGCTGTTTGTCGCGACCAAGGAGAT
CTGCAACGCGTACACGGAGCTCAACGACCCCATGGACCAGCGCCAGCGGT
TCGAGCAGCAGGCCGCCGACNAGGCCGCGGGCGACGACGAGGCCCAGATG
ATCGACGAGAACTTTCTGCAGTCGCTCGAGTACGGGCTCCCGCCCACGGN
CGGNTGGGGCATGGGCATCGACCGNCTCGTCATGATGCTCACCACGCGAA
ACACATCAGGAGTGCTCTGNTCCCNGCATGNAGCCATCGACAGTAAGTGT
TTTTCGCGTCTCTCTTTNGGTTCTGTCATCATCTNAGCATACCTCTCCCA
T
    




The gene BeE30N13H12 is related to E30-NOR-13-H12-U.AB1 ():

Sequence ID Image
E30-NOR-13-H12-U.AB1
No Image