Blastocladiella emersonii clone report

Clone ID BeE30N13F12
Best BLASTX Match gb|AAI10248.1|
Function Description Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) [Bos taurus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N13F12
TGGTCCCTGCAGTCCGGTCCGGACTTCCGGGTCGACCCCGCGTCCGCGCT
CGAGTCCAACCCCGACGTCCTCAACGAGCTGCTCGTCAAGCTCGGCGCAT
CGTCCAGCTTCACGTTCCAGGACGTGTTCGGCCTCGACGATGAGCTCCTC
GCTATGGTCCCGCCTGCCATCGCCGTGATCCTGCTCTTCCCAATTACCGA
GAAGTACGAGAGCTTCCGCCGCACCGAGCAGGCCGAGCTCGCGCGCACGG
GCCAGCCGGGGCTCCCCGCGTCCACCTACTTCATGCGCCAGACGGTCGGC
AACGCGTGCGGCACCGTGGCCGTGCTGCACACGCTGCTCAACAACGCCGA
CCGCGTTGTTGCGCCCGGTACCCCGCTCGCCGATATTCTCGCGGCAACGC
GCTCGCTCAACCCCGACGAGCGCGCCAAGTACCTCGAGGACGGCGAGACG
GTCGCGTCCATCCACTCGCAGGTCGCCCAGCAGGGCCAGACCGCCGCGCC
CGACGCCAACGAGGACGTGGACCTCCACTTTGTCGCGTTTGTCAACGTCG
ACGGCCACATTGTCGAGCTCGACGGCCGCAAGCCGTTTGCGATCGACCAC
GGCGCCGTGGATGCTGAGAACCCGGCGCTGCTTCCCACGTGGCTCGCGTC
GTGCGNCAGTTCATGGAGCGCGACCCGGGCAACATGCAGTTCACCCTCAT
GGCGCTCGCTGCCCGC
    




The gene BeE30N13F12 is related to E30-NOR-13-F12-U.AB1 ():

Sequence ID Image
E30-NOR-13-F12-U.AB1
No Image