Blastocladiella emersonii clone report

Clone ID BeE30N13F10
Best BLASTX Match gb|AAW46678.1|
Function Description conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N13F10
CGCACACACTTCCATGAATCTCTGAGACCATGTCATCGGCGATGACGACT
GCGAGTGTCGCAAAGCACCGGTCGCGGCGGTCGCGGCGGTCCCTGGACGA
CCCGGCACCGCCGCCCGCCTCGAGCGGCAGCGGCAGCAGCGAGTCGGGCG
ACGTGACCATGTCGACGCGGACAGCCATCGAGTCGTCGGCAGCAAACCGG
CCGCCGCGCCGCAAGCGGCACAGTCCGACGAACGTGATCCTGCCGTGGTG
CGACTACACGGCGCCCGCGTCCGCGCCGTCCGCCGCCGCGCTGACCGCCG
TCGGTGGCGGCACGCTGGTGCAGCGCGCACAGCGGTGGGTGTCGTCGCTG
TGGCCAAGCAGCAGCGAGTCGGCCGGCCTCCCGCCACCGCCGTGGACCGC
GGCGCACGGCGTTCCGCCCGAGCTCGCCGAGGTGTGCATCATCGGCGTGC
ACGGCTGGTTCCCGATGAAGTTTGTGCAGCGCGTGGTGGGCGAGCCGACG
GGGACGTCGGGCAAGTTCTGCGAGCAGATGGAGCAGGCGCTGCGGCAGTG
GGTGGCGGCGCACTACGGCGGCGCCGAGGTGCCCAGCGCGGCCATCACGT
CGATCGCGCTCGAGGCCGAGGGCAAGGTCGAGCACCGCGTC
    




The gene BeE30N13F10 is related to E30-NOR-13-F10-U.AB1 ():

Sequence ID Image
E30-NOR-13-F10-U.AB1
No Image