Blastocladiella emersonii clone report

Clone ID BeE30N13F08
Best BLASTX Match ref|XP_784012.1|
Function Description PREDICTED: similar to sperm-associated cation channel 2 isoform 1 [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N13F08
ATCATGGTCGGCGTCGTCGCAGAGCTCACGGACACCCAGGAAGATCACGT
CACGCTCTTCCAGGCCATTGACATCCTCGATAAGCTTTCGCTCGTCGTGT
TCTTTCTCGAAATCTTCCTCAAATGGCTCGACAACTTTGCGCGGTTCTGG
ACGGACGCGTGGAACGTGTTTGATTTCTCAGTCACCGTCGGAACCACCGT
GCCCGAGCTCATCGAGGCGTTTGGCGGTGCCTCGGTCGGCAATATCCGGC
TGGTCGTGCGCCAGCTCCGCACCTTTCGCATCCTACGTGCTTTGAAGCTC
GCCGTGCGGTTCAGCAGCTTGCGGATCATCGTGGTCACGATTATCGAGGC
ATTCCGCTCCATGGCGCTCATCATGGTCCTCCTATTCCTGGTCATCTTTA
TTTTCGCCGTCATCGGCGTGTACCTGTGCGAGCCCATGGCGCGGTCCAAC
ATCGACTCAAAGTACAAGTACTCGTTTGCGACGCTCGGAGCTAGCCTGGA
GGTTCTGTTCCAGTTCCTTACGCTCGATAACTGGGGCGACGTGGTCGACG
ACTTGATCAAGGTCATCGATCCGCTTCCGATTTACCTGTTCGCGATCGCG
TGGATCTTTTTCGGTGCCATCACGATGCGCAACACATTCACTGTCGTGCT
CGTCTCAAACTTTGACCGCATCAGCCGCGAGCTGCANGAGCGA
    




The gene BeE30N13F08 is related to E30-NOR-13-F08-U.AB1 ():

Sequence ID Image
E30-NOR-13-F08-U.AB1
No Image