Blastocladiella emersonii clone report

Clone ID BeE30N13D09
Best BLASTX Match ref|XP_747706.1|
Function Description amidohydrolase [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N13D09
GCAGATCACGCCGACCGACCGCGTCCACGGCATCATCCGCAACGGCGGCG
CCGCGCCCAACATCATCCCGGCCCACACGTCGGGGACGTTCATGACGCGG
TCGACCGAGATCGCGCACCTGCGCTCGTTTCTCCTCCCCAAGGTCCTCGC
GTGCATCGAGTCGGGCGCGCGGAGTACCGGGTGCACGTACTCGACGAGCA
TGCACCCGCCGTACTTTGACGTCAACACGAACGCGCCCATGGCCCAGGTG
TACGAGACCGAACTCCGCGAGCAGCTCGCGATCGCGCTCCCGTCGCCCGA
CGTCCAGAAGAGCATCTCCCGCGGCAGCACCGACTGCGGGAACATCTCGT
ACCTCGTGTGCCCGACCATCCACTCGGTTTTTGACACCGGGTGCAAGGCC
GAGATCCACTCGGTCGAGTTTCTCGCCCACGCCAAGACCGAGGAGGCGCA
CAACCACACGCTCGACCGCATCGCGTGCCTCGTCATGGTCGCGTTCCAGC
TGCTCACGGACGGGGACCTGCGCGACCGCGCACGCGCCGAGTTTGCACGG
TCGACCAAGACTGCCGAGGCCGCGGGCGTGTTCGACAGCACCGCGTGATG
GATGTCGCGTGCCCGATTTTGAATGCATCTCGTCATCTGCTGG
    




The gene BeE30N13D09 is related to E30-NOR-13-D09-U.AB1 ():

Sequence ID Image
E30-NOR-13-D09-U.AB1
No Image