Blastocladiella emersonii clone report

Clone ID BeE30N13C08
Best BLASTX Match dbj|BAC38993.1|
Function Description unnamed protein product [Mus musculus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N13C08
TCGTACTTTGAGGTCCTCGGCTACGCCTACTTCACGGGCTCGTTCCTCGT
CGGCCCGCAGTTCTCGTTCGCCCTGTACCGCCGCTACCTCTCGCTCGACC
TGTTCCGCACCCACACCCCGGTCGGCACCTCGACCCCGGCCGCCATCTCC
ATGCCGATCCCGCAGCTGCTGTCTACGGGCGCCAAGGCTGCCGCCAAGAC
ATTTGGCCTCGCCGTCGGCTACCTCGCCGTGACCCAGGTCCTGTCCATGT
TCTTCTCGTCGGCCATCGTCCTGACCCCGGCCTTCCTCGACGCGCCCTAC
TACCACCGCCTCGCCCTCGCGTGGATGGCCGGCAAGACGGCCCTCACCAA
GTACCTCGGCGTCTGGATCCTCACCGAGGGCGCCTGCATCCTCAGCGGCA
TGGGCTTCGACGGCGTCGACGCCAACGGCCACCCGCGGTGGTCGGGCCTC
GCCAACATCGACGCCCTCGGCTTCGAGACGGCCACCTCGCTCGCCCGCAT
CATCGGCACCTTCAACATCAACACCAACAACTGGGCCAAGCTGTACCTGT
TCAAGCGCCTCCGCTTCCTCGGCAACAAGCACCTCTCCTCGGTCGGCACC
CTCGCCTTCCTCGCCATATGGCACGGCTTTCATCCCTCGTACGCCTACGC
CTTCTCTTTGGAGTTTGTGGACATGATTGTCGAGTCCCGGC
    




The gene BeE30N13C08 is related to E30-NOR-13-C08-U.AB1 ():

Sequence ID Image
E30-NOR-13-C08-U.AB1
No Image