Blastocladiella emersonii clone report

Clone ID BeE30N13C05
Best BLASTX Match ref|XP_628997.1|
Function Description DNA repair exonuclease [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N13C05
CGCACCCGCTGCAACCTACCCGCCATCCCGCCCGCCGCGCCGATGCATCA
CGACGAGCTCGCGGACCCGGACGCGCCGTGCAACGCGCCGCGCGAGGACG
TGCTGTCGATCCTGATCGCGACCGACAACCACCTCGGGTACGCGGAGAAG
GACCCGATCCGCGGCAACGACTCGATTGCGACGTTCGAGGAGATCCTCAA
GATCGCGCAGGACCGCGCCGTCGATATGGTGTTGCTTGGCGGGGACCTGT
TCCACGACAACAAGCCGTCGCGCAAGACGCTGTACTCGACCATGGAGCTG
CTCCGCGCGCACTGCATGGGTGACCGGCCCTGCGCGCTCGAGTTTTTGAG
CGACCAGTCGGTCAATTTTCCGAACCGGTTCGCGACGGTCAACTACATGG
ACCCCAACTACAACGTGTCGATGCCTCTGTTCTCGATCCACGGCAACCAC
GACGATCCGTCTGGCGACGGCCTCGCGGCGCTCGACCTGCTCAGCGTGAG
CGGGCTGGTCAACTACTTTGGGCGTCAGCGCGAGGTGGACGACATCCTGA
TCACACCCGTGCTGCTGCGCAAGGGGATCACGTCGCTGGCGCTGTACGGG
CTGGGCAACGTGCGCGACGAGCGGCTGCACCGCACGTTCCTCAAGAAGAA
AGGTCAGATGCTGCGACCCATCGAGGGC
    




The gene BeE30N13C05 is related to E30-NOR-13-C05-U.AB1 ():

Sequence ID Image
E30-NOR-13-C05-U.AB1
No Image