Blastocladiella emersonii clone report

Clone ID BeE30N13A04
Best BLASTX Match ref|XP_758765.1|
Function Description hypothetical protein UM02618.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N13A04
GGCGCCGCGGCTTGCGCGCCTGCGACATGAAGTCGTTGACGCCGAACACG
TCGCCGGCGAACGCGGCTGCCGCGGCGGACGGGCCAGCTGCCGCCGGTGG
TGGGGCCAAGGTGGACGACGACGACGCGACCTTCTCGAACTCGACGGGCC
CGTCGCCGCGCGCGCTGCTGCCGTCGGCGCCCTGGAACCCGCGCCCGGCC
GCGGGCTGGAACCGGTCCGTCTTGCTGAGCTGCTCGTACGCCGCGTTTGC
GTCCGTTGCGCCGCCGTACATGTCCGAGTCGCCGCGCGCCGCGGGACGGT
ACACGGACGCGATCCCGGCGTGCGTGCCCGAGAACAGCGCGCTGTCGTAC
ACGTCGTACGCCTCGTCGTCGCCGAACCCGGACCCGAGCCCCTCGCTCTG
GTTGAACAGCCGCGAGTCGAACATGGCGTCCTTGGACACGGTCGGTTTGA
TGGCGCCGAGCGCAATCTTTCTCCGACACGTCGCGGTCCGCCATGGTCTT
GGCGTGCCGCGAC
    




The gene BeE30N13A04 is related to E30-NOR-13-A04-U.AB1 ():

Sequence ID Image
E30-NOR-13-A04-U.AB1
No Image