Blastocladiella emersonii clone report

Clone ID BeE30N13A02
Best BLASTX Match ref|XP_641226.1|
Function Description hypothetical protein DDBDRAFT_0206359 [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N13A02
CGCAACGCAGCCGCCACCATGTCGCTGTCGCAGACCGCCAACGTGCCGCG
GAGGCGGAGCAGCATCGCGGGCGGGAGCAACCCGTCGCTGTACATGCTCG
GGTCGGGCGGGCCGGTCCCGAGCGCGCCGCTCCCCTTCTCGGCGCTGCTG
GGAACCCCGCAGACAGCATCTAGCGTTTCCGCGGCTCCCACCAGCGGATC
GTCCGACAGCAGCGCCCTGCCGCCCGGCACGACGGCGACCGCGTCGCTCG
GCGCGCCACCGCCGCTGTTCGTCGTGCCCGACGCCTTCGCCCTCGTGGAG
CCCGGCATCTACCGCTCGAGCATGCTCGCGCCCGCCAACCTGCCGTTCAT
CCGCACCCTCGGCCTGCGCTCGATGCTCGTGCTCGCGCCCGAGGCGCCGA
ATCGGCATGTCCTCGCGTTCCTGGACGAGAACGCGATCGAGCTGGTCCAC
CTCGGCCAGCGCTCGTGGCGGTCGTCCGCGCCGGGCTGGCGGCCGATCCC
CGAGGAGCTGATCAAGGAGGCGCTCGAGTTCCTGCTGCAGCCCAAGAACC
AGCCCGTGCTCATCGCGTGCACGTCGGGCATCCACGAGACGGGCGCCGTG
GTCGGGTGCCTGCGCCGCCTGCAACGGTGGAACTTTACTCGATCGCCGTC
AAGTACCGCTCGTTTGCCGACACAAGGCCCGCTACGCCACCGAGCAGCTC
ATCGAGCTGTTCGACGTCTGCCTCATCACNCTGCCTGCCGCACCCCGGTT
GCTGCGGCATACCGCCCCGGCGAATGCTCTAATGAAGGACCCTTCTTGGG
    




The gene BeE30N13A02 is related to E30-NOR-13-A02-U.AB1 ():

Sequence ID Image
E30-NOR-13-A02-U.AB1
No Image