Blastocladiella emersonii clone report

Clone ID BeE30N11H10
Best BLASTX Match dbj|BAD11816.1|
Function Description putative S-phase specific ribosomal protein cyc07 [Lentinula edodes]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N11H10
ACAAACCCAAAGTCGTCTCTCCAACATGGCCGTGGGCAAGAACAAGCGTC
TCTCCAAGGGCAAGAAGGGTCTCAAGAAGAAGATCGTCGACCCCTTCTCG
CGCAAGGAGTGGTACGACATCAAGGCCCCCACGATCTTCTCGGTCCGCAA
TGTTGGCAAGACCCTTGTCAACCGCACCCAGGGTCTGAAGAACGCTTCGG
ACGCCCTCAAGGGTCGGGACCCACCCCGTCCAGAGGACCAGGCCTTCCGC
AAGATCCAGCTCCGCTGCGATGAGGTTGCCGGAAAGAACCTCCTGACCAA
CTTCCACGGCATGTCCATGACCTCGGACAAGCTCCGCTCCATGGTCAAGA
AGTGGCAGTCGACCATCGAGGCCCACATGGACGTCAAGACCACCGACGGC
TACCTGATCCGCGTCTTCGTCATCGGCTTCACCACCCGCGCCCACAACCA
GGTCGCCAAGACCTCGTACGCGCAGTCGGCCCAGATCCGCCAGATCCGCA
AGAAGATGTTCGACGTGATCTCGCGCGAGGCCACCACCGTCGACCTCAAG
GAGCTTGTCAAGAAGTTCGTCGCCGAGACCATTGGCCGCTCGATCACCAA
GGCCTGCGTCAACATCTACCCCCTGCAGAACGTGTTCGTCCGCAAGGTCA
AGATCCCCT
    




The gene BeE30N11H10 is related to E30-NOR-11-H10-U.AB1 ():

Sequence ID Image
E30-NOR-11-H10-U.AB1
No Image