Blastocladiella emersonii clone report

Clone ID BeE30N11H06
Best BLASTX Match ref|YP_143050.1|
Function Description unknown [Acanthamoeba polyphaga mimivirus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N11H06
GGAACCCCACAACTTGCCGTGCCTGCCCTTCGAGCTGATCGAGGCGATCC
TTGTGACGGCCGCGCGGCTTCCCGGTCAGCTACCGCGCCACCTGCGCGAG
CTTCTCCGCGTACTCCCGCGCCGCCAAGACGACACGTACAGTCCGCTTGC
CCGCTTCATCCTCACCCGGCTGCCCAACTGCCGGCCCAACTGGGCTGCCT
TCTACGGCCGCGTCGATGTGCTTCAAGAGTACCTCGCGTCCGGCCTCCCC
TTCGACTACTTGGGGGCCGCCATGGACAAGGCGAGCTACTCTGGCCACGT
TCCCGTCTTGGACTGGTTTGTTTCGTTGGGTCTCGAGCTCACGCACTCCC
GGAAAGCGGTCGAGTGGGCGTACCGCCACGACCAGTACGAGGCGCTCGCT
TGGTGGTTCAAGCGCGGCGAGTACGCCGACTTTTTCGCGACGCTTGTCGA
TTCCGCAAGTATGACCAACAACACCTGGTTTTTAAAATGGTGGGCCGCCG
CTGGCGACGTTGCGCTTCCTTACTCGGCCGCCGCCATCGACCACGCGAGC
GCAAAGGGGCACATCGGCGTGCTTGACATCTGGCGGTCGTCTGGTCGCGA
GCTCAAGTTTACGGAAATGGCGATTCACGAGGCCAGCGCGCATGGCAAGC
TGTCCGTCCTCGATTG
    




The gene BeE30N11H06 is related to E30-NOR-11-H06-U.AB1 ():

Sequence ID Image
E30-NOR-11-H06-U.AB1
No Image