Blastocladiella emersonii clone report

Clone ID BeE30N11H04
Best BLASTX Match gb|AAI21827.1|
Function Description Amidohydrolase domain containing 1 [Mus musculus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N11H04
GACCGGTCCGGAATTCCGGGTCGACCCCGCGTCCGCAACCATGACATCGC
ACGCCCAGCCCGAGTTCCTCGTCGCGTCGCCGGCGCCGGCCGCGGGCACG
ACGTTCCGCACGCTGTTCGCCAAGGCGGCCGAGATCGTGAGCGTGTGCGC
TGGTGGCGAGCCGTTCAAGACGGGCAAGGGCATGGACTCGCTGGCGACGT
TCAAGGACGCGTCGCTGCTCGTCGGCGGCGACGGCCGCATCGTGTTCGTT
GGCCCGCACGCGCACCTCGAGGCGCAGCCGTGGTGGCCCGGGTCGACGGT
CGAGACGACGGTCGAGTGCACCGGCAAGTCGCTGGTGCCCGGTTTTGTCG
ACGGGCACACGCACCCGGTGTTTGCGGGCGACCGCGTGCACGAGTTTGCG
CTCAAGCTCGCGGGCGCGACGTACCTCGACATCCACAAGGCGGGCGGCGG
GATCGGGTTCACGGTGACGCACACGCGCGCCGCGTCCGAGGACCAGCTGT
TTGCCGACCTGCAGCAGCGCATCACGCGCATGACGCGCGCCGGCACGACC
TACGTCGAGGCCAAGTCGGGCTACGGGCTCGACCCGGCGACCGAGGTCAA
GATGCTGCGTGTCCTGACGCGGCACAACCGGTCGGCGCACCCGACCAAGG
TCAGCGTCACGTACCTGNGCGGGCACTCGGTGCCCAAGAAACAGTCGCTG
GCCGACTACACGCGC
    




The gene BeE30N11H04 is related to E30-NOR-11-H04-U.AB1 ():

Sequence ID Image
E30-NOR-11-H04-U.AB1
No Image