Blastocladiella emersonii clone report

Clone ID BeE30N11G05
Best BLASTX Match ref|YP_645518.1|
Function Description transcriptional activator, TenA family [Rubrobacter xylanophilus DSM 9941]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N11G05
GACGAAGCAGCCCCAACATACATGCGCACGCAACTCGGTGCATCGGCCGC
GTTGGCTGAGCGCGCAGCAGCTGCCCGAGGGTTGAGGAGTATTTGAACCC
ACCGGGCCCGCGCTCGGGCTTCCACTCTCCCCTTCGAGGATGCATCCACC
CGTCGCCGACAATACCATGATCGCCGTGCCCAAGCCCGACACCCACAACA
ACGGCACCACCACCAAGGCCACCGGCATCGCCGCCGAGTGCCTGGACAAG
CACAGCGCCGGGTGGTCGGCGCTCACGGGCAACGGCTTCCTCAAGGCCCT
GCGCGACGGCTCGCTGCCCGACACCATGTTCAACCGCTGGCTCATGCAGG
ACTACCTGTTCGTCGTCGAGTTCACCAAGCTGATGGGCGAGCTGTTCGCG
CTGGCCCCGCGCCGCGACGTTCCCACTCTATTCTCGGGCTTCGCCGCCGT
GCGCGACGAGGTGGCGTGGTTCGAGTCGCACCTGGCCCGCCTCGCCGCCA
ACGGCGTGCAGCACGTCGGCGTGCCGTCGCCCGACTTTGTCTCGGTCTCG
ACCACCCCGGCCGAGCTGCGCGGCACGCCGATCGCGCCTCTCCCCGCGTG
CGCCGAGTTCATCCAGTTCCTCGCCGACCTGCGCTCGCGCGCCCGCACCC
TCGCGGCGGGTGGCGACTCCGCGCACGCGT
    




The gene BeE30N11G05 is related to E30-NOR-11-G05-U.AB1 ():

Sequence ID Image
E30-NOR-11-G05-U.AB1
No Image