Blastocladiella emersonii clone report

Clone ID BeE30N11E09
Best BLASTX Match gb|EAU34955.1|
Function Description DNA mismatch repair protein msh-2 [Aspergillus terreus NIH2624]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N11E09
GACCTACCTCCACGAGTTTACCTGTGTCCCGCTGCACACCTTCGGCTTCA
TGCGTCTCGATGCCCACGCCGTCGGCGCCCTCGACCTGTTCGGCGACGGT
CCGCGCCGCCCCGCCCACCTTTTTGGCCTGCTCAATCACTGCATCACCCA
GCCCGGCTCGCGCCTGCTCGCTCAGTGGTTGCGCCAGCCGCTCGCCGACC
GTACCGCCATTGCCGCGCGCCTTGAGCTCGTTGAGGCCATCACCGACTCG
GCCGATGCCCGCGACAGCATCCGCGCCTTTCTCCGCGGCCTGCCCGACCT
CCCGCGCCTCACCAAGAAGCTGCGCCGCGGCAAGGCCGCCCTGCCCGACG
TTGTCCTGCTCTACCAGATGGCCGTGCGCATCGCCGAGCTGCTCCCCGCC
CTCGCCCACGACCAGCGCCTCGTGGACCGCTTTGCCGCACCCGTCGAGCA
GGCCGTCGCCGATCTCGCCGAGTTTATCCGGCTCGTGGAGGACATGGTCG
ATCTCGACGCCGTTGAGAACCACCAGTTCCGCGTCCTACCCTCGGTCGAC
CCCGAGCTCATGGCGCTTCACAGCCAGATTGCCGCACTCGAGGCGCTCGT
CCAGCCCGAGGCCGAGAAAGCGGCCAG
    




The gene BeE30N11E09 is related to E30-NOR-11-E09-U.AB1 ():

Sequence ID Image
E30-NOR-11-E09-U.AB1
No Image