Blastocladiella emersonii clone report

Clone ID BeE30N11D12
Best BLASTX Match gb|AAI21925.1|
Function Description Unknown (protein for MGC:146209) [Xenopus tropicalis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N11D12
TTCCATCCTGCGCCAGGACCGCTACGGCGCAATGAAACGCCTCGCGTCGG
GGCAAGGTTGCCGCGCACGTCGTGTGCACGACGTGGATCCGCGACGCGCA
CTTTCTCGATGCCGAGCGGCTGGCCGACATCAGCGTCGCGAGGATCCCGC
CGCGCGACTGGCTACGACCGTGCGCCATCTGCGGGCTCGTCGAGGGCGTC
ACGGTACCGTGCGACGCGGGCCGGTGTCCGCGGCGCGTCCACGTCTCGTG
CTGCGCGGAACACGACCTGGTCGAGGAGGTCCGCGACGAGCCCGGGCTCG
CGAACCCGATGTTCCTCGTCTGCCCGCAGCATGGCGCTGTCCAAGACGCN
AGCCGGGTCAAGCTGAACAAGTGGGGCCGCTGGGCACGCGCCCACGCCCT
GCCCTCCTCCGATCCAAGGCCGCTGCCGCCAAGAAACCGCCAGTTAAGCG
GCGGCGAGCGCCCGCTGCTGCAGCGGAGCCGGCGGCGGTGCGGCCACCGC
GACCCGACGAAGCGGACGCGTCGTTCATAAGCGGGTGGGCGGAGAATACA
GCGAAGCTCGTGCCCACAAGCTCCACAAGCTTTGTCAGCGCCTTTGAAAT
CAAAAAAACAAAACATAATATCACACCCCC
    




The gene BeE30N11D12 is related to E30-NOR-11-D12-U.AB1 ():

Sequence ID Image
E30-NOR-11-D12-U.AB1
No Image