Blastocladiella emersonii clone report

Clone ID BeE30N11B11
Best BLASTX Match gb|EAL22654.1|
Function Description hypothetical protein CNBB1040 [Cryptococcus neoformans var. neoformans B-3501A]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N11B11
CGCCATCCAGTCGATGCAAGCGCCGGAGCTCGCCGCCATGGTGCGCGACA
AGTCGCTGCGGCCGGGCCGCGACTACCTGGTCGTGGACGTGCGCGACGAC
GACTTCGTCGGCGGCAACATCCCGCACGCGCGCAACGTGCCGTCGCACAC
GCTGCACGACCCGGACGTGGCGGCCAAGCTCGCCGCCGACGTCAAGGACG
TGCCCAAGCTCATCTTCCACTGCGCCCTGTCGCAGCAGCGCGGGCCCAAG
GCCGCCATGTACATGGCCCGGCTCCTCGGCCCCGAGCGCACCGCCGAGAT
CTACGTCCTCATCGGCGGCTTCTCCAAGTGGCAGGACGCGTACAGCGACC
AGCCCGACCTGCTCGAGAACTACGACGCCAAGATGTGGTCCAACGAGTGG
TGGAACTAGGTCGGGGAGAGAGAACGTAACTGATA
    




The gene BeE30N11B11 is related to E30-NOR-11-B11-U.AB1 ():

Sequence ID Image
E30-NOR-11-B11-U.AB1
No Image