Blastocladiella emersonii clone report

Clone ID BeE30N11A11
Best BLASTX Match gb|EAQ85205.1|
Function Description hypothetical protein CHGG_09219 [Chaetomium globosum CBS 148.51]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N11A11
CGCGTCCGGTACCTCCAACGAGCGCACCGTCCGCCCGCACCATGGATCTA
CTGTTCAACGTCGTCGAGGCGTTGGGCACGTGGNTCGCGCCGCTCGTCAT
CTCGCTCGTGTCGCTGACCATCCTCTCGCTGCTGCTGTACCGCCGCCCCG
CGGGCAAGAACATCTGCGTGTCGCTGCCGTCCAAGGACCCGACCCACTCG
CCGCGCTACCGCCACTACCGCGCCAAGGACGGCCTGCTCACGACCCCCAA
CCCGGCCATCAAGACCATCCACGACCTGCTCGTCTTCGCCGCGCGCGAGG
CGGGCAACAGCCCCATGCTCGGCTCGCGCAAGCGGCTGCGCATCCACGAG
GAGCAGAAGCTCGTCACCAAGGTGGCCGCCGGCCAGGAGGTCAAGGAGAC
CAAGACCTGGCAGTACTACGAGCTCACCGACTTCCGCTGGATCACCGCCA
AGGAGGCCCTCGCCCGCTCGCTCACCATCGGCGCCGGCCTCGTCAAGCTC
GGCTTCAACGTCGGCGACAAGGCCTGCATCTACGCCCAGACCTGTGCCGA
GTGGCGTCTCTTTGCCCACG
    




The gene BeE30N11A11 is related to E30-NOR-11-A11-U.AB1 ():

Sequence ID Image
E30-NOR-11-A11-U.AB1
No Image