Blastocladiella emersonii clone report

Clone ID BeE30N10E05
Best BLASTX Match gb|EAU32901.1|
Function Description conserved hypothetical protein [Aspergillus terreus NIH2624]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N10E05
CGCAACACGCTGCAATGAATTCACTGTACCAGAACCTGCTGCGGCAAAAC
GACACGCTGTGCACGCTGCTCGATCGCGCCGAGCAGGGCTACCTGAACGA
CGCCGTTGCGAATCAGGTGCAGACGGCGTTCGGTAACCTGGAGCGGTCGC
TCGCCGACTACAACGAGTTTTCGAAGCGCGAGATCAACGTGGCCAAGCGA
GAAAAGGCGCTCATTCGGTCAAAAAAGTTTAGCGACGACCTGAGCCAGCT
GCGCGAGCGGTGGACAAGGGTGCAGGCGCGCGGGGTGCAGCAGCAGGCGT
ACGCGGACCAGCGCAACGACCTGTTCCACCGAAGCGGTGCGCCGAGTGGT
GGTGGCGTACAGATCAACCTCGGCGGGCCCGCGGCCAACGAGTACTACTC
GCACGAGTCGGCGCGGCTGCACGCGACCGAGTCGCAGCTCGACGAGTACC
TGGCCATGGGCCAGTCGATGCTCGGCAACCTGACGGACCAGCGCAACATG
CTCAAGCGCACGCACCGGCGCATCCTCGACGCGGCCAACACGCTCGGGCT
GTCGCGCACGCTCATCGGGTACATTGAGCGCAGGGGCGTCCAGGACAAGT
GGCTGTTCGCGGCCATGGCGCTCGTCTCGCTCGGCCTCATGTGGGCCATG
ATCCACTACCTGCGGTGAATACACGAACGCCGCGATCGGCTTGAGCTC
    




The gene BeE30N10E05 is related to E30-NOR-10-E05-U.AB1 ():

Sequence ID Image
E30-NOR-10-E05-U.AB1
No Image