Blastocladiella emersonii clone report

Clone ID BeE30N10D12
Best BLASTX Match ref|XP_692927.1|
Function Description PREDICTED: similar to component of oligomeric golgi complex 3 (predicted) [Danio rerio]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N10D12
GCAGGTACGGTCCGGAACTCCGGGTCGACCCCGCGTCCGCCACGGCGTGC
TGCGCGATGCCACCGACCGCCTCATGCGCGACAAGGGTGAGGTGGAGCGT
ATCGCGCGCGAGATCGAGACGCACCTCGGGCACTTTGCTTTCCTCGAGGA
CTTTGCGCAGTGGGTCAATCAGTCGCCGCTGCCGCTTGAGCCCGCCGAGA
CCCTCGCTGCGCCGCTCGCGCGCGCCGACGAGTGCATGGCGTTCATGGCG
GCCAATTCACACTTCACCGACGCGGCGCTGTACCACGCGCGGTTCCGCCA
GTGCATGACCAAGGCTATGACGGCCGTGCGCAACCACGTCGTTGGTGTCG
TCCGCGGTCTTGCGCGATCTCCGCCCGACCTGCTCACCGCGGCGGGCGTC
TCTGGCTCGGGTAGTGGCGGCGATGTTGGGTCGACCTCGCCCAAACTCGA
CCTCCAGTCGATTCTTCCTTCTCCTTCCGCTTCTTCACCCGCGCAGCAGC
ATCGAGGCGCTGACGCCGTGGTCTCGCTCATGGCCGTGGTCCAAACGGCA
CCGTGGGCGCTCACCTTCCGCGCGGCCTGTACCGCTGCGGGTCCCATCAT
GCGCGAGCTCACGTCGCGCTGCGTCGACCATCCCGAGTACCACGCGCTGC
GCGCCGAGTGCGTCAACGCGTACCTCACCACGCGGCACCAGATTGTTGGC
CCGATCGTGGACGCGCT
    




The gene BeE30N10D12 is related to E30-NOR-10-D12-U.AB1 ():

Sequence ID Image
E30-NOR-10-D12-U.AB1
No Image