Blastocladiella emersonii clone report

Clone ID BeE30N10D08
Best BLASTX Match ref|XP_759778.1|
Function Description hypothetical protein UM03631.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N10D08
CCCGCGTCCGCGGACGCGCTGGGGTAACACCCACGCCACCATGAGCTACT
CGCGCACCGACGACAACGGCAAGGACACGATCCACTTTGTGACGGCCGAT
GACCACACCTCCCCCTCCTCCGACGAGCCGCAGGGCGCCGTGAGCGCAAC
GGGCGAGATCAACTGGGACTGCCCGTGCCTGGGCGGCATGGCGTACGGCC
CGTGCGGCGAGCAGTTCCGCGACGCCTTCTCGTGCTTTGTGTACTCGGAG
ACGGACCCCAAGGGCATCGACTGCGTCGACAAGTTCCAGGCCATGCAGGA
CTGCTTCCGCGAGCACCCCGACGTGTACGCCGACGAGCTGCGCGACGACG
ACGAGGACGCGCCCAAGGAGGTCGAGCCCGCGGCGCCGGCCGCGGATGCC
GACGTGGTTGCCGATGCGACGGCCGAGGAGACAGTCGCTGAGGCGAACGA
GATCGAGGAGCCAGCACCCGTGTCCGCGTAATCGCTCGTGTGGTCGATCT
TGTCCAATACAATCCCCTAGCCTGTATGAANNNNNNNNNNNNNNNNNNNN
NNNN
    




The gene BeE30N10D08 is related to E30-NOR-10-D08-U.AB1 ():

Sequence ID Image
E30-NOR-10-D08-U.AB1
No Image