Blastocladiella emersonii clone report

Clone ID BeE30N10D01
Best BLASTX Match ref|NP_055199.1|
Function Description acyl-Coenzyme A dehydrogenase family, member 8 [Homo sapiens]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N10D01
TGCTCGCTCGCTCCGCTCTCCTGTCGGCCTCGCGCTCGGCTGCGCGCCCC
GCCGCCCGCCCCATGGCCGCCCGCGCCATGTCGTCGATCATTGACCCGAC
CATGGGCCTGACCGAGGAGCAGTGCCAGATTTTCGAGACGTCGCGCGCCT
TCGCCAAGGCCGAGATGGGCCCGCGCGCCTACGAGCTCGACATGAAGGAG
ACGGAGCTCCCGCGCGACCTGTTCAAGGCCGCTGGCGAGCTCGGCTTCGG
CGGCGTCTACGCCGACCCCGACTTTGGCGGCGCCGGTATGACCCGCATGG
ACGCGGCGCTCATTTTCGAGGCCCTCAGCACCGTCGACGTCTCGACCTCG
GCTTTCATCTCGATCCACAACATGGCCCTTTACATTCTCGACTCGTTCGG
CAGCCAGGAGCTCAAGCAGAAGTACCTCCCCTCGCTCACCACCATGGACC
ACGTCGCCTCGTACTGCCTGACCGAGCCCGGTGCCGGCTCTGACGCGGGC
AACCTCGCCACCACCGCCAAGCGCGACGGCAAGAACTGGAAGCTCAACGG
CTCCAAGCAGTTCATCAGCAACGCCGGCGGCAGCGACATCTACATCGTCA
TGGCCCGCACCGGCGGCCCTGGGCCCTCGGGCATCAGCGCCTTCGTCGTC
GACGCCAACGACGCCGT
    




The gene BeE30N10D01 is related to E30-NOR-10-D01-U.AB1 ():

Sequence ID Image
E30-NOR-10-D01-U.AB1
No Image