Blastocladiella emersonii clone report

Clone ID BeE30N10C05
Best BLASTX Match ref|XP_367161.1|
Function Description hypothetical protein MG07086.4 [Magnaporthe grisea 70-15]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N10C05
CTGCCACGGAGCACCCACGCATCGACCACCTCCCACGAAACTCCCCGCAA
CGAAGATGTCGGGCAACAACCAGCGGCTGGCCGTGTTCCCGACGCGCATG
GCGCTGACGACCATGAAGCTGCGGCTCAAGGGGGCGCAGACGGGCCACTC
GCTGCTGAAGCGCAAGTCCGAGGCGCTGACCAAGCGGTTCCGGGCGATCC
TGGGCAAGATCGACGAGGCCAAGCGCAAGATGGGCAAGCTGATGCAGGGC
GCGGCGTTCTCCCTGGCCGAGGTGACGTACGCGACGGGCGACATCTCGTT
CGCGGTGCAGTCGGCGGTGCGCCAGGCGCAGCTGCGCGTGCGCACCAAGC
AGGAGAACGTGTCGGGGGTGATGCTGCCGGCGTTCGAGCTGTACAGCGAG
GGCGGCAACGCCTTCGAGCTGACGGGGCTCGGGCGCGGCGGGCAGCAGAT
CGCGCGCGCCAAGGACGTGTACGCCAAGGCGGTCGCGCAGCTCGTCGAGC
TCGCCTCGCTGCAGACGGCGTTCGTGATCCTCGACGAGGTGATCAAGGTC
ACGAACCGCCGCGTCAACGCCATCGAGTTTGTCATCATCCCGCGCGTCGA
GAACACGATCAAGTACATCACGTCCGAGCTCGACGAAATGGACCGCGAGG
AGTTCTTCCGCCC
    




The gene BeE30N10C05 is related to E30-NOR-10-C05-U.AB1 ():

Sequence ID Image
E30-NOR-10-C05-U.AB1
No Image