Blastocladiella emersonii clone report

Clone ID BeE30N10C04
Best BLASTX Match gb|AAP80675.1|
Function Description ste20-related protein [Triticum aestivum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N10C04
TGCAGTCCGGTCCGGAATTCCGGGTCGACCACGCGTCCGGACCCGCCCAC
GCTCGACCGCGACGCCACGCGGTTCCGCTTCAGCAAGGCCGCCAAGGAGA
TGGTCGACCTGTGCCTCCAGCGCGACCCGACGCGCCGCCCGACCGCGGAA
AAGGTCCTCGGCCACCCCTTCTTCAAGCTCGCCAAGAAACCCAGCTGGCT
CGTCCAGCACCTCCTCGCCGGCCTACCGCCGCTCCCGGAACGCGCGCGCC
GCCGCGCCGCGCAGCCCGCGGCCCCGCGGAACGGGAGCAACGCGACGCCG
GGTGATGCGCGACGCGGGTCCGGCCACGGCGGCGGCGGGAACGCGCCCAT
CTCGTGGGACTTTGATACACCCGACTCCCCCGGCCCGTCGCCCGCCGCGC
TCCTCGCTGCCGAGATGATGGCGATCGCGCCGCCGGCGGCGCAGCAGCAG
CAGCAGCAGAACGCGGTTGTCGGGCTCGGGATCGACGCCGCCGGCGCGGG
TGCCCCGCCCGCCGTCCCGCCAAAGGAGACCAAGCGCGGCCGGTTCTCCG
TCTCGGACAACCTTTCGTCGAGCGACCTGCCCGGCGCCGCAGCGGCGGCG
GCGGCGGTTGCGGCAAGTGCGGCGGGTACGGGGAAGCCGTTCTCGCCGCC
GTCCGGGATCGTCACCGCGAAC
    




The gene BeE30N10C04 is related to E30-NOR-10-C04-U.AB1 ():

Sequence ID Image
E30-NOR-10-C04-U.AB1
No Image