Blastocladiella emersonii clone report

Clone ID BeE30N09G11
Best BLASTX Match gb|EAU35586.1|
Function Description hypothetical protein ATEG_03784 [Aspergillus terreus NIH2624]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N09G11
CGAGAGAACCCTCGCCTGACGACTACACACCATGGAGGCCTCGACCGTCA
CCGTCCCGTCGGACCTGCCGCGCCACTCGAGCGAGATCACGGCCGCGCAC
GGCGCGACGCCGCCGACCATGGCGAGCTCGGTCAAGGCCGCGCTCTTCGC
GTCCAAGCTCAACGTCCTGCTCGTCTTCGTGCCCATCGGCATCATCGCCG
GCGAGCTGCACTGGAACGACGTGCTCGTTTTCTGGCTCAACTTCGTGGCC
ATCATCCCGCTGGCCAAGCTGCTCAGCTTCGCGACCGAGGAGCTCGCCAT
GTACACGAACCAGACCATCGGCGGCCTGCTCAACGCCTCGTTTGGTAACG
CGACCGAGCTGCTCATGTCCGTGATCGCCCTCACCAAGGGCCTCGTCCAC
GTCGTGCAGGCCTCGCTCCTCGGCTCAATCCTGTCCAACCTCCTGCTAGT
GCTCGGCGCCTCGTTCCTCGCCGGCGGCATGAAGTACACGGAGCAGACCT
TCAACGCCACCGCCGCCAACACCTCCGCGTCGCTGCTTTCCATCGCCGTC
ATGGCCCTGCTCATCCCCGCCGCCTTTGTCGGCGCCGCCAAGACCGACCC
TCAGGAGACCGAGGGCCGCGTTCTCGCGCTG
    




The gene BeE30N09G11 is related to E30-NOR-09-G11-U.AB1 ():

Sequence ID Image
E30-NOR-09-G11-U.AB1
No Image