Blastocladiella emersonii clone report

Clone ID BeE30N09C12
Best BLASTX Match gb|AAY58912.1|
Function Description putative 3-isopropylmalate dehydratase large subunit [Hyaloperonospora parasitica]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N09C12
CCGGTCCGGAACTCCGGGTCGACCCCGCGTCCGGTACTTCCGCCCCGACA
CCAAGGCCCAGTACGCGGCGTCGCACACCATCGACCTCGGCCACGTCGAC
TCGCTCGTCGCCCTGTACCCGTCGCCCGACAACGTGGTCCCCGTCGTCGA
GGTGGCCGGCAAGAAGCTCGACGGGTGCTTCATTGGCGCGTGCACCACGG
CCGAGGAGGACCTGATCCTCGCCGGGCTCGTGCTCCGCGCCGGTCTCGCG
CGCGGGCTCGTCCCGGCGCTCGGCGGTAAGCGCAAGGTGACCCCCGGCTC
GGTCCCCATCGTCAACAAGCTGCGCCGCCTCGGGCTCGTCGCCGTGTACG
AGCAGGCCGGGTTCACGGTCGGCGTGCCCGGGTGCTCGTACTGCCTGGGC
ATCGCGGCCGACGTCGCCGGCGAGAGCGAGGTGTGGCTGTCGTCGCAGAA
CCGCAACTTCAAGAACCGCATGGGTAAGGGCTCGATCGGCAACCTCGCGT
CCGCGGCCACGGTCGCCGCGTCGTCGTTCGACATGAAGATCACGGACCCG
CGCGAGCTCCTCGACGCCGTCGACGAGTCCGAGTTCAAGCGCATGTGCGC
GTTCATGGACGTGACCCCCGAGCTCTNCGCCCAGGGCGCGCCCTTCACCG
TCACGGAGCCCAAGTGCGAGTGGCTCGAGT
    




The gene BeE30N09C12 is related to E30-NOR-09-C12-U.AB1 ():

Sequence ID Image
E30-NOR-09-C12-U.AB1
No Image