Blastocladiella emersonii clone report

Clone ID BeE30N09C10
Best BLASTX Match ref|XP_783848.1|
Function Description PREDICTED: similar to hydroxyacylglutathione hydrolase [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N09C10
GACGGCGACGGCAACGAAGAACCCATGCACGCAGCGCGACTGAGAGCCCT
CGCAAGGCCGCTCCTCCGCGCTCACGGACCTCACGCTCTCCTCCGACCCT
TCTCGACGAGATCAACGATCCGGGCCGCCATGATGAAAGTGTACCCGGTG
CCCTGCCTGAGCGACAACTACGCCTACGTGCTCGTCGACGAGACGACCAA
CGAGGCGGCGGTGGTGGACCCGGTTGAGCCATCCAAGGTGCTGGCCAAGG
TGGCCGAGCTCGGCGTCGACGTGCGGGCCGTGCTGACGACGCACCACCAC
CACGACCACGCGGGCGGCAACAGCGAGTTTGTGCGGCAGTGCGCGGTGCC
CGTGTACGGCGGCGACCAGCGGATCCCGGCGCTGTCGCACCCGGTGGGCG
ACGGCGACGCGCTGCGCGTCGGGTCGATCGCCGTGCGCGCCATGCACACG
CCGTGCCACACGACGGGCCACATCTGCTTCTACTGCGAGCCGGCGGACGG
CGGCGCCAAGGCCGTGTTCTCGGGCGACACGCTGTTCCTGGGCGGGTGCG
GGCGCTTCTTCGAGGGCGACGGCGAGCAGTTTCAGGCCAGCCTCGACAAG
CTCGCGGCGCTGCCCGACGACACGCTCGTGTACTGCGGCCACGAGTACAC
GCTGAA
    




The gene BeE30N09C10 is related to E30-NOR-09-C10-U.AB1 ():

Sequence ID Image
E30-NOR-09-C10-U.AB1
No Image