Blastocladiella emersonii clone report

Clone ID BeE30N09C02
Best BLASTX Match ref|XP_760929.1|
Function Description hypothetical protein UM04782.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N09C02
CAACAAGAAGGTCATCGACCCCGTCGCCCCGCGCCACGTCGCCCTCGACG
CCGCCGGGCTCGTCCCCGTCGCTCTGACCGGCGACGGCGTCCCCGCCAAG
CTCGAGACCAAGCCCCTGCCCAAGCACAAGAAGAACGCCGACGTCGGCAC
CAAGCAGACGGCGTTCGCCAAGCACCTCGTCCTCGCCGCCGCCGACGCGC
AGGCGATCGCCGACGGCGAGGAGGTCACGCTCATGGACTGGGGCAACGCC
ATCTGCACCCGCGTCCACCGCGACGCCGACTCGGGCACCGTCACCCGCAT
CGACGCGACGCTCAACCTCGCCGGCGACGTCAAGGCGACCAAGAAGAAGC
TCACGTGGCTCGTGGACCCGGCCAAGTACCCCGCCACCGCCGCCCAGGTC
ACGCTCATAGACTACGACTACCTCATCACCAAGAAGAAGCTTGAGGAGGA
CGACGACTACACGTCGGTCCTGACCCCCGTCACCGAGTTCGCCACGCACG
CCGTGGGTGACACGAATCTCGCGCAGCTCAAGGCCGGCGACATCATCCAG
CTCGAGCGCCGCGGGTACTTTATCTGCGACGCCGTCGACGGCAAGAAGAA
GGCCGTCACCCTGATCGCGATCCCCGACGGCAAGGCCGCGTCGCTCGCGT
CCAGCACGG
    




The gene BeE30N09C02 is related to E30-NOR-09-C02-U.AB1 ():

Sequence ID Image
E30-NOR-09-C02-U.AB1
No Image