Blastocladiella emersonii clone report

Clone ID BeE30N09C01
Best BLASTX Match ref|XP_001116048.1|
Function Description PREDICTED: polymerase (DNA directed), delta 1, catalytic subunit 125kDa isoform 1 [Macaca mulatta]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N09C01
GGCCCCATGGAGTCCGGGTCCGCGTCGGCGCTCGTCCAGGGCACCTCGTC
GGCCGCCAACGTGCCGGGCAGCGCCGCCATGAAGCGCAAGGCCGACCCGG
CCCCCGCCCCCGCCGCCGCCGCGGGCAAGCGCCGGCGCACCGAGGCCACC
ACGCCGCCGAGCTCGCAGCCGCCGCTTTCGGAGGAGCAGTCCGAGTTCGA
GAAGACGCTCGCGGGGCTGCACCTGACTCAGACCGAGGCGGTCGGCGTCG
ATCCGACGCTGTCGTGGCCGCGACCCGCGCTCGACGGACCCTGGGACGCG
GCGACGCGCGACCTCGTGTTCCAGCAGATCGAGGCCGATGAGCACACTGA
GGTCGCGCCCGACGGCCTGCCGCAGCTCCTGCAGCAAGTCCCGCAGCTCG
TGCCCGTCGCGCGCCAGGTCGTGTTCCCGACGCTCCGCTTCTACGGCGTC
ACCGACGAGGGGTATAGTGTTACTTGCCACGTCCACGGGTTCTTCCCGTA
CATCTACGTCCCTGCCCCCAACGCGTTCCATGACGGCATGCGCGGCGAGT
TTGTCGCTACCCTCAACCGGCTCCTCCACTCGGACCGCAAGGGCACGCAC
CCGACCGGCTACGTGCTGGGCGTCGACATCTGCCTCAAGGAGTCGATCAT
GCACTTCCAC
    




The gene BeE30N09C01 is related to E30-NOR-09-C01-U.AB1 ():

Sequence ID Image
E30-NOR-09-C01-U.AB1
No Image