Blastocladiella emersonii clone report

Clone ID BeE30N09B07
Best BLASTX Match gb|AAP75564.1|
Function Description malate synthase [Chlamydomonas reinhardtii]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N09B07
CACGGGCCCCGTGGACCGCAAGATGGTCATCAACGCGCTCAACGCGGGCG
CGCAGACGTTCATGGCCGACTTCGAGGACTCGACGGCGCCGACGTGGGAG
AACGTGGTGCTCGGCCAGCAGAACATGAAGGACGCCATCTACCGCTCCAT
CTCGTTCACGGCGCCCAACGGCAAGGAGTACAAGCTGCGCGACGACGGCA
AGGTCGCGGTTCTGCTCGTCCGCCCCCGCGGCTGGCACATGGAGGAGAAG
CACCTGCTCATCGACGGGCAGCCGTGCTCGGCGTCCATTTTCGACTTTGC
GCTCTACTTCTACCACACGGCGTGGAAGTCGGTGGAGATTGGCCAGGGCC
CGTACTTTTACCTGCCCAAGATGGAGTCGCACCTCGAGGCGCGGCTGTGG
AACGACGTGTTCAACATGGCGCAGGACTGGATCGGCATGCCGCGCGGCAC
GATCCGCGGGACCGTGCTCATCGAGACGATCCTGGCCGCCTTCGAGATGG
ACGAGATCATCTACGAGCTGCGCGAGCACTCGGCCGGGCTCAACTGCGGC
CGGTGGGACTACATTTTCTCGTACATCAAGAAGCTGCGCCAGCACCCGCA
GTTTGTGCTCCCCGGCCGCGCCGACGTGACCATGACCACCCCCTTCATGG
ACGCGTACGTGCGCCTGCTCATCCAGACGTGCCCACAGCGCGGCGTGCA
    




The gene BeE30N09B07 is related to E30-NOR-09-B07-U.AB1 ():

Sequence ID Image
E30-NOR-09-B07-U.AB1
No Image