Blastocladiella emersonii clone report

Clone ID BeE30N09B04
Best BLASTX Match emb|CAA19037.1|
Function Description erg24 [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N09B04
CTGCAGGTCCGGTCCGGAACTCCGGGTCGACCCCGCGTCCGCCTCGTGCG
GGTGCCCTTCAGCTACTCGCTGCAGGCGCGGTACCTCGCCATGCACGATG
CCACCTTCCTCGGCCCCGTGCCCGCCGCCGCCATCCTCGCCGTCAACCTG
CTCGGGTACTGGATCTTCCGGTCCGCCAACTCGGAAAAGGACGCGTTCCG
CAGCAACCCGAACGCGCCCGACGTCGCCCACCTCAAGTACATGGAGACGG
CGTCCGGCAGCAAGCTCCTCGTCTCGGGCTGGTGGGGGATCGCCCGCCAC
ATCAACTACTTTGGCGACTGGATCATGTCCGTCGCGTGGTCGCTCCCCTG
CGGCTTCGCCGACCCGCTGCCCTACTACTACCCGATCTACTTTGCCATCC
TCCTCGTCCACCGCTTCTACCGCGACGAGCACAAGTGCAAGTCCAAGTAC
GGCAAGGACTGGGACGAGTACTGCCGCCGCGTCCCCTCGCGCATCGTGCC
GTACGTGTTTTAGCGGGAGCGGTCCGCGAGGCTCGCAGAGGTTTTGTTGC
AAATGTAAGTTGTATTTCCAATCNNNNNNNN
    




The gene BeE30N09B04 is related to E30-NOR-09-B04-U.AB1 ():

Sequence ID Image
E30-NOR-09-B04-U.AB1
No Image