Blastocladiella emersonii clone report

Clone ID BeE30N08G04
Best BLASTX Match ref|XP_760081.1|
Function Description hypothetical protein UM03934.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N08G04
CGAGCCTCTGTCGGCGAGCCACCCGTCGCCTCCCTCAAAGGAGATTGCGC
ACATTGTGATCCCGGACCCGGCCTACTCGCTCGAGCTGTACACGCAGTCG
GCGCAGCTCGGGTACGCGCCGTCGCAGTTCCGCCTCGGCACGTGCTTCCA
GGACGGCGACCTCGGGTGCCCCGTCGACGCCAAGGCCTCCATCATGTGGT
ACACGCGCGCCGCCGAGCAGGGCCACCCGGACGCCGAGCTCGCCCTGTCC
GGCTGGTACCTCGAGGGCGCCGACGGCGTGCTGCCGCCCAACGACGAGCA
GGCCTACGCCTGGGCCCGCCGCGCCGCCGACAAGGGCCTGTCCAAGGCCG
AGTTCGCCGTCGCCTACTACCACGAAATGGGCGTCGGCGTCCCGCAGTCG
CTCGAGGAAGCCCGCCGGTGGTATCAGCGTGCTGCCGCCCAGGGAAACCG
CAAGGCCATGGACCGGTTGCAGGACATGCGCAACTTTGCCCGCAACGCCG
GTAACGCCGCCCCCGCCAAGCGCGACAAGGGCGACTGTACCATCATGTAG
TCCAAGCCGTGCCGTCCGACTCGACTCCGTCCGTTTTGCTACACTAGATC
TGCTGTTCCTACCGCCCGCTCGCTCGACTCTCCCAGCTGCTTGTATCACT
ATCCTCCTCCCACATCACCCGCTGGGGAGCCCGGNAGCGGNTCCNACT
    




The gene BeE30N08G04 is related to E30-NOR-08-G04-U.AB1 ():

Sequence ID Image
E30-NOR-08-G04-U.AB1
No Image