Blastocladiella emersonii clone report

Clone ID BeE30N08F02
Best BLASTX Match ref|XP_503106.1|
Function Description hypothetical protein [Yarrowia lipolytica]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N08F02
GGAACTTCCCAAGAATCGCAAGCATACGAGTCTAACACGATGCATCGCGC
GGCCGGGCTCACGACGGGCCTCCTGCGGATCGCGGCGCCGCGCAAGTCCG
CGTCGACGGACGCCACCCCCGCCGCGGGCGTGCTGGCGGAGGGCCGCTCG
ATCCGCGGATGCGTGTTCGACATGGACGGGACGCTGACGGTGCCGGTGCT
CGACTTTGCGCTGATGAAGCAGCGGCTCGGGCTGCAGGCGCACCACGACA
TTGTCAAGGAGGTGTACGCGATGCCCGAGCCGGATCGGTCGGTGGCGCAG
GCGATCATCGTGGAGATGGAGCGCGAGGCCATGGAGGCGATGACGATGGC
GCGCGGGTTCCACGGGGTGATGCGAGCGCTCGAGGCGGCGCGGGTGCCCA
AGGCGATCCTCACGCGCAACAACATGGAGCCCGTCGAGCACCTGCTCACG
CACCACGCGCCCGACTACGCGTTCCACCCGGTCGTGACGCGCGACACGGT
GCAGCCGACCAAGCCGCACGCCGACCCGCTGCTGCACATAGCCCAGATCT
GGGGCGTGCCGGCGCACGAGCTGGTGATGGTGGGCGACGGCGAGGACGAC
GTGCTGTGCGCGCGTGCGGCGGGCGCGGT
    




The gene BeE30N08F02 is related to E30-NOR-08-F02-U.AB1 ():

Sequence ID Image
E30-NOR-08-F02-U.AB1
No Image