Blastocladiella emersonii clone report

Clone ID BeE30N08C09
Best BLASTX Match ref|XP_758525.1|
Function Description hypothetical protein UM02378.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N08C09
CACACGACGCTGCTCGGCAACGTGTTCCGGTTCGCCGAGCTCGACACGAC
CGTCAACTTTTTGGCGAAATCGGCGTGCTCGGCCGCGCTCACGCAGCCGC
TCGCCACGGTGCGCACGCAGCTGACGGAAAAGTGCGTCAAGGTGCTGGCG
TCGTACCGCAAGAACTGCGCGTCGTCGACGTCGCCCGGCCAGCTCATCCT
GCCCGAGACCTTCAAGCTGTTCCCGCTGTGCACGCTCGCCCTGCACAAGC
ACCGCGCCCTCAAGGCGGGCGACCTGCCGAGCGACGTGCGCGTCGCCGCC
ATGCGCGAGCTCCGGTCCCTCGCCGTCCCGCTCTCGGTCCCGCTCCTCTA
CCCGCGCGTCTTCTCGCTCCACGCCGAGAACGACCCGCAGCCCGTGCGCG
CGTCGTACGAGCGGCTCGACCCCGCCGGGTGTTACCTGCTCGAGAACGGC
CAGATGGCCATGCTGTGGCTCGGCCGCCAGATCGCGCCCGACCTCGTGCA
GCAGATCCTGGGTGTGCCCGCGCTCGAGGCCATTGACCTCCGCACCCACG
TCCTCCCCGCGCTCGACACGCCCGCGTCGCGCCGCGTCCAGGCGCTGCTC
GCCGATATCGCGACCCGGTACCACCGGCACCTCAGCGTCCAGATCGTCCG
CCAGGGCGTCG
    




The gene BeE30N08C09 is related to E30-NOR-08-C09-U.AB1 ():

Sequence ID Image
E30-NOR-08-C09-U.AB1
No Image