Blastocladiella emersonii clone report

Clone ID BeE30N08B04
Best BLASTX Match ref|NP_001027509.1|
Function Description hypothetical protein LOC613101 [Xenopus tropicalis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N08B04
GGCCCTGCAGTACGGCCGGATCCCGGGTCGACCACGCGTCCGGCAACGCA
TCGACACTAGTTCGCGCACGGCACTCCCTGCACGATGCTCCGCCACGCCG
CCCACTCGCTTCTGCCAGCCGCCGCCGCGGCGATGCGTCCCGCGCCGCTT
GCCCGCGTGGCCGCGCCCGCCATGATGATGCAGGCCCGCTGCGCGTCCGG
GCTCGTGTCCAAGAAGATGAACTTTGCGATCAGCGAGACCGGCCGCATCA
TCGACCCCTACGTCCGCCCCGACAAGGTGCCCAAGCCGTTCTCGGCCGAG
GGCCGCTCCGCGCTCTTCACCTACCTCAAGAACCTCGCGCAGAGCACCTT
TGAGGTGTCCCGCCTGAAGCGCGATATCAAGTTCGTCGCCACCCAGTTCC
CGCTCGAGGCCGAGGAGCTGTACAAGCAGATGAACAAGGCCTTTGCCGAG
GGCCGCCCGAACGACGTGGAGCCGTTCGTCACCAACCAGATGCTCTCGAC
GCTCAAGAACCAGATGCGCAAGCGGCCCGGCACGCTGTCGTGGGAGTACC
TCGGCGCCGTGGAGCGGCCCAAGACGGTCAACCTGCGCTACTCCAAGGGC
CAGGGCGACCCGTTTGGCGTGGCCCAGGTCACCATCAAGCTGCACACCAA
GCAGCGCCTCACCATCACCGACTCGTCGGGCAAGGTCCTCGCCGCCACCG
AGTCGGACCCCGTCGAGTACGTCGTCTACGAGCGCTTTCACACCCGCCAC
GGCAAGTGGCGCATCGCTGCNCAGATCGACCTCGCCAGCAGCAACAGTAC
CTAGCTGTCCACACAAACAAAATCAATGGTATCTCCCTCCTAGTACGCT
    




The gene BeE30N08B04 is related to E30-NOR-08-B04-U.AB1 ():

Sequence ID Image
E30-NOR-08-B04-U.AB1
No Image